El verde luce en todo su esplendor entre Hellín y el Xorret de Catí

Nueva cita con La Vuelta y nuevo éxito cosechado por parte de los compañeros de Globalcaja, Caixa Popular y Seguros RGA que han vuelto a hacer del verde el color protagonista en salida, meta y Parque Vuelta.

La jornada ha arrancado en tierras albaceteñas con una nueva localidad de estreno en lo que a salida de La Vuelta se refiere como es el caso de Hellín, que se ha lanzado a la calle para recibir a la serpiente multicolor.

Así que, ante un recibimiento así, no podíamos hacer otra cosa que volver a echar el resto por los colores de Caja Rural – Seguros RGA en la zona de Punto de Encuentro al tiempo que los chicos de nuestro equipo también volvían a poner su mejor ánimo para atender las peticiones de fotos y autógrafos que se iban sucediendo una y otra vez.

De este modo, nos hemos encontrado un stand en Punto de Encuentro atestado de aficionados y también de corredores ya que los Jaime Rosón, David Arroyo, Rafa Reis, Héctor Sáez y compañía se han dado se han acercado a visitarnos, a compartir un buen ratito con aficionados y reponer fuerzas de cara a la dura etapa con llegada en el Xorret del Catí.

Además, allí han estado Jaime Rodríguez y Pablo Lara de Seguros RGA prestando todo tipo de atenciones a los invitados y amigos que se han ido acercando a esa zona a los que hay que sumar también dos corredores del Sky de Chris Froome como son los casos de Gianni Moscon y Salvatore Puccio así como el veterano, Nicolas Roche, ahora en las filas del BMC.

Por tanto, ambiente en la zona de salida y mucho ambiente también durante todo el recorrido de la mano de una caravana publicitaria en la que Mauricio Mazzuccheli y Pablo Lara han vuelto a hacer llegar los colores de Caja Rural y Seguros RGA por todos los lugares de paso de la carrera.

Y si ambientada estaba la zona de salida no menos lo estaba un Parque Vuelta instalado en Ibi en el que todos los compañeros y compañeras de Caixa Popular de Ibi, Alcoy y alrededores junto con el grupo de voluntarios de Seguros RGA de María José Gracia, María Teresa Álvarez, Silvia García y Elena Bascones se han multiplicado para que todos los asistentes disfrutaran al máximo de la fan zone.

Y la cosa no era tarea fácil puesto que había un calor sofocante bajo un intenso sol de agosto que ha provocado, incluso, el reventón de una de las ruedas de la bici solidaria. Pero nuestro mecánico del Caja Rural – Seguros RGA ha cambiado rápidamente la rueda como si de una carrera se tratara porque había que seguir sumando kilómetros, tantos como 1406 que se transformarán en 4218 euros a favor de la Asociación Tetrasport de Valencia.

Por tanto, nueva jornada de objetivo cumplido dando guerra en todos los rincones y en todos los terrenos como ha tratado de hacer nuestro equipo ciclista durante la etapa. Aunque hoy los ‘gallos’ de la carrera no han dejado apenas margen para soñar.

Así que de esta manera es como llegamos a una primera semana de competición que culminaremos con un etapa entre Orihuela y Benitatxell que plantea el reto doble de fan zone de salida y Parque Vuelta prácticamente durante todo el día. ¡Juntos podemos!

GALERÍA DE IMÁGENES

Etapa 8 La Vuelta (Hellín - Xorret del Catí)

Nueva y ampliada fan zone pero un mismo espíritu solidario

La Vuelta coge velocidad de crucero y también lo vamos haciendo nosotros con la esperada puesta en marcha de nuestra nueva y renovada fan zone con un mundo de posibilidades para todas las edades y que ha tenido una magnífica acogida en su primera puesta de largo en la meta del Puerto de Sagunto.

Y es que ante la posibilidad de que puedan montar en bici pequeños y grandes, el atractivo de hacer en bicis del equipo ciclista dos tramos míticos de La Vuelta, las gafas de realidad virtual, los globos, el castillo hinchable, el photocol para participar en sorteo de un crucero y el sorteo diario de maillots son alicientes más que suficientes como para dejarse caer por nuestras carpas de Caja Rural y Seguros RGA.

Por supuesto, todo eso sin olvidarnos del importante propósito solidario que acompaña cada una de estas acciones y que, en esta ocasión, se ha saldado con 930 euros que irán a parar a la Asociación Tetrasport de Valencia gracias a la solidaridad de todos los amigos y amigas que han pedaleado en nuestras bicis y a Caixa Popular.

No obstante, el día ha dado para mucho empezando por la afluencia masiva de seguidores a una salida en Villarreal junto a un estadio de La Cerámica en el que el ‘submarino amarillo’ le ha cedido el protagonismo a la ‘serpiente multicolor’ que ha tomado las calles de esta localidad castellonense.

Y precisamente por encontrarnos en este terreno, hemos podido contar con visitas como la de Paco Albiach, Director General de Ruralnostra, Hipólito Guinot y José Luis Ballester, Consejeros de Caixa Almassora o también de José María Company, Director de negocio y márketing de Caixa Popular que ha venido acompañado de Fernando y Álvaro Zárraga, dos clientes de la Caja que han podido disfrutar de la extraordinaria oportunidad de vivir la etapa en el coche de equipo. Una vez en meta han confesado que han “alucinado” con la experiencia.

No obstante, también había que estar al pie del cañón en nuestro stand de Punto de Encuentro, hoy situado prácticamente sobre el arco de salida. Y de eso se han encargado Juan Pablo Factor y Jorge Díaz de Seguros RGA.

Vuelvo a insistir en que teníamos muchas ganas de poder contar con la presencia de voluntarios que hacen las etapas más divertidas, entretenidas y variadas, sobre todo, cuando hay que pasar muchas horas dentro de un coche a baja velocidad como ocurre en una caravana publicitaria en la que Mauricio Mazzucchelli sigue al mando de las operaciones junto con María José.

En cualquier caso, hoy tocaba repartirse porque había muchos frentes abiertos puesto que la carrera pasaba por oficinas de varias de las cajas de la zona que no han dudado en echar el resto para teñirlo todo de verde y también hay que estar pendientes de aprovechar la llegada en la playa del Puerto de Sagunto para que se viera bien la lona gigante en apoyo a nuestro equipo desde el helicóptero. Hay que decir que los sudores de Mayte García y el grupo de compañeros de Caixa Popular que la han estado colocando ha merecido la pena.

Y una vez cumplidas estas misiones llegaba el momento de reponer fuerzas junto a los compañeros de Caixa Popular de cara a una larga y calurosa tarde en el Parque Vuelta.

Por otra parte, en lo deportivo, buen papel de nuevo por parte de un equipo ciclista que sigue muy activo y que se ha metido en la fuga del día de la mano de David Arroyo. La consigna era venir a dar guerra y eso es lo que están haciendo los hombres de Eugenio Goikoetxea.

Y guerra es la que queremos dar cada día en una fan zone que, como dije al principio, hoy hemos estrenado con buena nota capitaneada por nuestro gran Vicente Aguado (cómo echábamos de menos tus auauauauauauauauauauauauauauauauauauaggggg), con Loli López, Cristina Muñoz, Paloma Sánchez, Jose Antonio Barrios y Juan Pablo y Jorge que han hecho doblete.

Eso sí, a todos ellos hay que sumar una ingente cantidad de voluntarios de Caixa Popular que parecía que salían de debajo de las piedras puesto que han sido muchísimos los que se han dado cita en la fan zone para permitir que este estreno haya sido todo un éxito y que este primer día de deporte y solidaridad se haya saldado con casi 1000 euros para la Asociación Tetrasport de Valencia.

Y con lo que se está saldando nuestro paso por la comunidad valenciana es por una apuesta decidida por promocionar su plato estrella, la paella. Paella ayer para comer, paella hoy para comer, paella hoy para cenar… ¿Qué tendremos en el desayuno?

Ahora la carrera sigue y el reto que tenemos que afrontar es doble puesto que habrá fan zone tanto en la salida de Liria como en la meta de Cuenca. Así que no esperes más y #SúmateAlVerde.

GALERÍA DE IMÁGENES

Etapa 6 La Vuelta 2017 (Villarreal - Sagunto)

Pintamos de verde playas, rascacielos y cumbres

La Vuelta Ciclista a España nos ha dejado este sábado una jornada de contrastes entre la abarrotada playa de Benidorm, donde ha tenido lugar la salida de la misma, y la base militar de Aitana, que ha sido el punto final a una carrera repleta de emociones.

Emociones como las que han vivido en el coche del equipo ciclista tanto Roberto como María José, invitados de Caixa Popular y Seguros RGA que han disfrutado de la etapa del día junto a nuestro Director Deportivo, Eugenio Goikoetxea.

Una cita que nos ha dejado nervios y tensión sobre todo cuando nuestro hombre para pelear en esta jornada, Sergio Pardilla, ha sufrido una avería mecánica que ha hecho que haya tenido que trabajar duro junto a varios compañeros para reintegrarse al grupo.

Etapa 20 La Vuelta 2016 (Benidorm - Aitana)

Hablando de grupo, hoy ha vuelto a repetirse el equipo formado por Esther Pérez, Beatriz y Carlos de Seguros RGA en un Punto de Encuentro absolutamente peculiar puesto que se encontraba sobre la misma arena de la playa de Benidorm.

No obstante, es no ha impedido que hayan vuelto a ser muchos los invitados que, una vez mas, han estado poblando el paseo marítimo con nuestras bolsas, bolis, imanes y banderitas.

Etapa 20 La Vuelta 2016 (Benidorm - Aitana)

La verdad es que Benidorm ha sido un bonito y concurrido punto de salida para una última etapa valenciana en la que no ha faltado a su cita con nuestra marca el Director de Negocio y Márketing de Caixa Popular, José María Company.

Sin duda, un terreno de contrastes entre el mar, los rascacielos, los turistas y toda la parafernalia que conlleva una gran carrera como La Vuelta.

Etapa 20 La Vuelta 2016 (Benidorm - Aitana)

Y de ahí nos tocaba poner rumbo a una etapa con muchas dificultades montañosas y un recorrido también algo distinto al habitual para una caravana publicitaria en la que María Bercial se ha tenido que multiplicar para atender en soledad las incesantes demandas de “dame, dame, dame…” y “aquí, niña, aquí…”. Sigue leyendo

Requena y Gandía reciben a la serpiente multicolor con entusiasmo y un nuevo récord en la Bicicleta Solidaria

Hermoso ‘pique’ el que estamos viviendo estos días en los diferentes rincones donde estamos llevando a cabo una Bicicleta Solidaria con el Banco de Alimentos cuyo récord se va rompiendo a diario como ocurría este jueves en Gandía donde se han alcanzado los 1336 kilómetros recorridos.

Sin duda, una cifra formidable de la que tienen buena culpa los compañeros de Caixa Popular así como los de Seguros RGA que se han estado multiplicando durante toda la tarde para que toda la gente que quisiera colaborar pudiera hacerlo.

Y no es cualquier cosa de lo que estamos hablando porque solo hay que echarle un vistazo a la cola de gente que había a poco de echar el cierre a nuestra Fan Zone con la ilusión y el ánimo de hacer su contribución a la Bicicleta Solidaria para darse cuenta de las ganas de colaborar de Gandía.

Etapa 18 La Vuelta (Requena - Gandía)

Ya nos advertía de esa buena predisposición el Presidente del Banco de Alimentos de Valencia, Jaime Serra, que ha estado dando pedaladas en nuestras bicis junto al Director General de Caixa Popular, Rosendo Órtiz, y el Director de Negocio y Márketing, José María Company.

También han hecho lo propio, como no podía ser de otra forma, la Alcaldesa de Gandía, Diana Morant, así como la Concejala de Deportes, Lydia Morant, que también han pasado por nuestra Fan Zone para poner su granito de arena.

Etapa 18 La Vuelta (Requena - Gandía)

Por todo ello, no es de extrañar que se haya vuelto a establecer un nuevo récord solidario que solo está a expensas de lo que ocurra el último día en Madrid para ver si es la mejor marca definitiva o no de esta Vuelta 2016. Aunque lo realmente importante es la suma de solidaridad que se ha podido realizar a lo largo de estas tres semanas por los diferentes rincones del país por los que ha estado discurriendo la prueba. Sigue leyendo